Prev. |  KEGG KO K00419 > 

RIKEN DNA Bank Human Resource - UQCR10

Gene ID NCBI Gene 29796 |  KEGG hsa:29796
Gene Symbol UQCR10
Protein Name ubiquinol-cytochrome c reductase, complex III subunit X
Synonyms HSPC051|HSPC119|HSPC151|QCR9|UCCR7.2|UCRC
Ortholog resources KEGG ortholog (KEGG orthology K00419) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086422 IRAL016A22 pDNR-LIB BC005402 NM_013387 Full
HGY092966 IRAL032G22 pDNR-LIB BC015971 NM_013387 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096418 M01C041A18 pDONR221 MGC10-B09 BC005402 NM_013387  
HGE096466 M01C041C18 pDONR221 MGC10-B09 BC005402 NM_013387  
HGE096514 M01C041E18 pDONR221 MGC10-B09 BC005402 NM_013387  
HGE096562 M01C041G18 pDONR221 MGC10-B09 BC005402 NM_013387  
HGE096610 M01C041I18 pDONR221 MGC10-B09 BC005402 NM_013387  
HGE096658 M01C041K18 pDONR221 MGC10-B09 BC005402 NM_013387  
HGE096706 M01C041M18 pDONR221 MGC10-B09 BC005402 NM_013387  
HGE096754 M01C041O18 pDONR221 MGC10-B09 BC005402 NM_013387  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041347 ARe03G03 pKA1U5 NM_013387.3  
GGGCGCGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACT
HKR062954 ARe57G10 pKA1U5 NM_013387.3  
GGGTGGCGCGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGT
HKR064858 ARe62C10 pKA1U5 NM_013387.3  
GGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTGCTGTT
HKR067650 ARe69C02 pKA1U5 NM_013387.3  
GGCGGTGGCGCGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATT
HKR179701 ARi49E05 pGCAP10 NM_013387.3  
GGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTG
HKR181331 ARi53F11 pGCAP10 NM_013387.3  
GGCGGTGGCGCGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATT
HKR234865 ARiS087C17 pGCAP10 NM_013387.3  
HKR260258 ARiS150K18 pGCAP10 NM_013387.3  
GGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTGCTGTTC
HKR322026 RBb05B02 pKA1U5 NM_013387.3  
GAGGCGCGGTGGCGCGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGA
HKR324550 RBb11G06 pKA1U5 NM_013387.3  
GGGTGGCGCGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGT
HKR326879 RBb17D07 pKA1U5 NM_013387.3  
AGGGTGGCGCGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTG
HKR346032 RBb65B08 pGCAP1 NM_013387.3  
GGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTG
HKR347673 RBb69D01 pGCAP1 NM_013387.3  
GGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTGCTGTT
HKR364570 RBd11H02 pGCAP10 NM_013387.3  
GGGCGCGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACT
HKR381371 RBd53H03 pGCAP10 NM_013387.3  
GGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTGCTGTT
HKR382079 RBd55D07 pGCAP10 NM_013387.3  
GGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTGCTGTTCCGCAGG
HKR405461 RBdS013K21 pGCAP10 NM_013387.3  
GGCGGTGGCGCGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATT
HKR406065 RBdS015C17 pGCAP10 NM_013387.3  
GGGCGCGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACT
HKR406256 RBdS015K16 pGCAP10 NM_013387.3  
GGCGAGTTGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCC
HKR432738 RBdS081O02 pGCAP10 NM_013387.3  
GGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTGCTGTT
HKR442358 RBdS105O22 pGCAP10 NM_013387.3  
GGGACTGTGAAGAAACATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTGCTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl