Prev. |  KEGG KO K06275 > 

RIKEN DNA Bank Human Resource - PARVB

Gene ID NCBI Gene 29780 |  KEGG hsa:29780
Gene Symbol PARVB
Protein Name parvin beta
Synonyms CGI-56
Ortholog resource in our bank

  PARVB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033868 IRAK084L04 pCMV-SPORT6 BC039811 NM_013327 Partial/var
HGX043028 IRAK107J12 pCMV-SPORT6 BC046103 NM_013327 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054526 ARe36F06 pKA1U5 NM_013327.3  
ATCCTGGGCTCCACACGCGCTGCGCCCGCCGCCGGCCCCACGCGCGGCCCATGTCCTCCG
HKR187226 ARi68B02 pGCAP10 NM_013327.3  
CGGCCGGCCGATGGGCCACTCCCCGGGGCGACCGGGCGGCTCCACACGCGCTGCGCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl