Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ABT1

Gene ID (NCBI) 29777
Gene Symbol ABT1
Protein Name activator of basal transcription 1
Synonyms hABT1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K14785)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX037568 IRAK093P08 pCMV-SPORT6 BC048812 NM_013375 Full
HGY067145 IRAK167O09 pBluescriptR BC066313 NM_013375 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021228 W01A053B04 pENTR-TOPO IRAK167O09 BC066313 NM_013375  
HGE021230 W01A053B06 pENTR-TOPO IRAK167O09 BC066313 NM_013375  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172145 ARi30G01 pGCAP10 NM_013375.2  
GAGTCAACATGGAGGCAGAGGAATCGGAGAAGGCCGCAACGGAGCAAGAGCCGCTGGAAG
HKR187301 ARi68E05 pGCAP10 NM_013375.2  
GAGTCAACATGGAGGCAGAGGAATCGGAGAAGGCCGCAACGGAGCAAGAGCCGCTGGAAG
HKR260008 ARiS150A08 pGCAP10 NM_013375.2  
GAGTCAACATGGAGGCAGAGGAATCGGAGAAGGCCGCAACGGAGCAAGAGCCGCTGGAAG
HKR387635 RBd69B11 pGCAP10 NM_013375.2  
GAGTCAACATGGAGGCAGAGGAATCGGAGAAGGCCGCAACGGAGCAAGAGCCGCTGGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl