Prev. |  KEGG KO K20123 > 

RIKEN DNA Bank Human Resource - PACSIN3

Gene ID NCBI Gene 29763 |  KEGG hsa:29763
Gene Symbol PACSIN3
Protein Name protein kinase C and casein kinase substrate in neurons 3
Synonyms SDPIII
Ortholog resources KEGG ortholog (KEGG orthology K20123) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088319 IRAL020N07 pOTB7 BC007914 NM_016223 Full
HGY091314 IRAL028E18 pOTB7 BC011889 NM_016223

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098843 M01C047B19 pDONR221 MGC13-C10 BC007914 NM_016223  
HGE098891 M01C047D19 pDONR221 MGC13-C10 BC007914 NM_016223  
HGE098939 M01C047F19 pDONR221 MGC13-C10 BC007914 NM_016223  
HGE098987 M01C047H19 pDONR221 MGC13-C10 BC007914 NM_016223  
HGE099035 M01C047J19 pDONR221 MGC13-C10 BC007914 NM_016223  
HGE099083 M01C047L19 pDONR221 MGC13-C10 BC007914 NM_016223  
HGE099131 M01C047N19 pDONR221 MGC13-C10 BC007914 NM_016223  
HGE099179 M01C047P19 pDONR221 MGC13-C10 BC007914 NM_016223  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR474939 RBdS187F19 pGCAP10 NM_016223.3  
GGCGGGCCCAGGAGCGGCAGGACTCGGGCCGGAGCGTGGCCGGACCCCCACCCGCCGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl