Prev. |  KEGG KO K10638 > 

RIKEN DNA Bank Human Resource - UHRF1

Gene ID NCBI Gene 29128 |  KEGG hsa:29128
Gene Symbol UHRF1
Protein Name ubiquitin like with PHD and ring finger domains 1
Synonyms ICBP90|Np95|RNF106|TDRD22|hNP95|hUHRF1|huNp95
Ortholog resources KEGG ortholog (KEGG orthology K10638) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR442093 RBdS105D21 pGCAP10 NM_013282.3  
GGCGACCCGCGCGGGCCAGTGGGAGTGCGGGAGGGACGCCGAGGGTCCAGGGTTTGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl