RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - UHRF1

Gene ID	NCBI Gene 29128 \| KEGG hsa:29128
Gene Symbol	UHRF1
Protein Name	ubiquitin like with PHD and ring finger domains 1
Synonyms	ICBP90\|Np95\|RNF106\|TDRD22\|hNP95\|hUHRF1\|huNp95

Ortholog resource in our bank

  UHRF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR442093	RBdS105D21	pGCAP10	NM_013282.3
HKR442093	GGCGACCCGCGCGGGCCAGTGGGAGTGCGGGAGGGACGCCGAGGGTCCAGGGTTTGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl