Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANKRD11

Gene ID (NCBI) 29123
Gene Symbol ANKRD11
Protein Name ankyrin repeat domain 11
Synonyms ANCO-1|ANCO1|LZ16|T13
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K21436)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04491 SEREX clone BRC-Co-24 #1 SEREX clone BRC-Co-24 #1

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY097758 IRAL044G14 pOTB7 BC041585 NM_013275 Partial/var
HGY099277 IRAL048D05 pDNR-LIB BC058001 NM_013275 Partial/var
HGY090414 IRAL026A14 pOTB7 BC007975 NM_013275 Partial/var
HGY097095 IRAL042M07 pOTB7 BC025283 NM_013275 Partial/var
HGY097400 IRAL043I08 pOTB7 BC031340 NM_013275 Partial/var
HGY101785 IRAL054H17 pOTB7 BC069013 NM_013275 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014460 W01A036C12 pENTR-TOPO flj0021e05 AK093762 NM_013275  
HGE014462 W01A036C14 pENTR-TOPO flj0021e05 AK093762 NM_013275  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186972 ARi67H04 pGCAP10 NM_013275.4  
GGACAGTCCTCGTCAGCACTGACTTTCAGCTATGGAATCGCAGACGGTTGATGATGAAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl