Prev. | 

RIKEN DNA Bank Human Resource - SAP30BP

Gene ID NCBI Gene 29115 |  KEGG hsa:29115
Gene Symbol SAP30BP
Protein Name SAP30 binding protein
Synonyms HCNGP|HTRG|HTRP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX019974 IRAK049P14 pCMV-SPORT6 BC030233 NM_013260 Full
HGX056615 IRAK141I23 pCMV-SPORT6 BC063793 NM_013260 Full
HGY084266 IRAL010L02 pOTB7 BC013409 NM_013260 Partial/var
HGY089079 IRAL022L15 pOTB7 BC007592 NM_013260 Full
HGY091121 IRAL027N09 pOTB7 BC011724 NM_013260 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009510 W01A023M22 pENTR-TOPO IRAL022L15 BC007592 NM_013260  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR342811 RBb57A11 pGCAP1 NM_013260.6  
TTGGCTGTGGGAATAAGATGGCGGGGAAGAAGAATGTTCTGTCGTCTCTCGCAGTTTACG
HKR361369 RBd03H01 pGCAP10 NM_013260.6  
GGAGCCACGCCCGGGCTGTGGGAATAAGATGGCGGGGAAGAAGAATGTTCTGTCGTCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl