Prev. |  KEGG KO K05410 > 

RIKEN DNA Bank Human Resource - TBK1

Gene ID NCBI Gene 29110 |  KEGG hsa:29110
Gene Symbol TBK1
Protein Name TANK binding kinase 1
Synonyms FTDALS4|IIAE8|NAK|T2K
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Toll-like receptor signaling pathway - human
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human
Featured content Mitophagy - human
Ortholog resource in our bank

  TBK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14330 pCXN2-FLAG-hTBK1(WT) Expression vector of FLAG tagged human TBK1, wild type.
RDB14331 pCXN2-FLAG-hTBK1(KD) Expression vector of FLAG tagged human TBK1, deletion mutant of ubiquitin-like domain (ULD) and coiled coil domain (CC) (306-729 AA).
RDB14332 pCXN2-FLAG-hTBK1(ULD+CC) Expression vector of FLAG tagged human TBK1, deletion mutant of kinase domain (KD) (1-304 AA).
RDB15225 pCA-hTBK1-GFP Expression vector of human TANK binding kinase 1 (TBK1), tagged with GFP, CAG promoter.
RDB15226 pCA-hTBK1-HA Expression vector of human TANK binding kinase 1 (TBK1), tagged with HA, CAG promoter.
RDB15227 pCA-hTBK1-Flag Expression vector of human TANK binding kinase 1 (TBK1), tagged with Flag, CAG promoter.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013444 IRAK033K04 pBluescriptR BC034950 NM_013254 Full/var
HGY090099 IRAL025E03 pOTB7 BC009864 NM_013254

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE008553 W01A021G09 pENTR-TOPO IRAK033K04 BC034950 NM_013254  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324810 RBb12A10 pKA1U5 NM_013254.2  
GGAGTCTCGAGGAGGCCGCGGGAGCCCGCCGGCGGTGGCGCGGCGGAGACCCGGCTGGTA
HKR376475 RBd41D03 pGCAP10 NM_013254.2  
GAGTGTCCTGAGTCTCGAGGAGGCCGCGGGAGCCCGCCGGCGGTGGCGCGGCGGAGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl