Prev. | 

RIKEN DNA Bank Human Resource - SCG3

Gene ID NCBI Gene 29106 |  KEGG hsa:29106
Gene Symbol SCG3
Protein Name secretogranin III
Synonyms SGIII
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084414 IRAL011A14 pOTB7 BC009511 NM_013243 Partial
HGY087874 IRAL019L10 pDNR-LIB BC014539 NM_013243 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007124 W01A017N12 pENTR-TOPO IRAL019L10 BC014539 NM_013243  
HGE007126 W01A017N14 pENTR-TOPO IRAL019L10 BC014539 NM_013243  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR371683 RBd29D11 pGCAP10 NM_013243.2  
GACTTCCTCTCCAGGAGGGAGCGAGAGTAAAGCTACGCCCTGGCGCGCAGTCTCCGCGTC
HKR405815 RBdS014I23 pGCAP10 NM_013243.2  
GCTCTACCTGGAGACTTGACTCCCGCGCGCCCCAACCCTGCTTATCCCTTGACCGTCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl