Prev. |  KEGG KO K15544 > 

RIKEN DNA Bank Human Resource - SSU72

Gene ID NCBI Gene 29101 |  KEGG hsa:29101
Gene Symbol SSU72
Protein Name SSU72 homolog, RNA polymerase II CTD phosphatase
Synonyms HSPC182|PNAS-120
Ortholog resource in our bank

  SSU72

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081122 IRAL002N10 pOTB7 BC008070 NM_014188 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR361724 RBd04F04 pGCAP10 NM_014188.2  
GGGGCCTTGTGGAGTGCGGGTCTCTGCTGCGGACGCCGGGGGCCGGCGCGGCGTTGGCCG
HKR390434 RBd76B10 pGCAP10 NM_014188.2  
GGCCNCNNNNNTCAGCCGGGCCTTGTGGAGTGCGGGTCTCTGCTGCGGACGCCGGGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl