Prev. | 

RIKEN DNA Bank Human Resource - COMMD9

Gene ID NCBI Gene 29099 |  KEGG hsa:29099
Gene Symbol COMMD9
Protein Name COMM domain containing 9
Synonyms C11orf55|HSPC166|LINC00610
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087969 IRAL019P09 pDNR-LIB BC010892 NM_014186 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247534 ARiS118N22 pGCAP10 NM_014186.3  
GGACTTCGGCAAGATGGCTGCCCTGACAGCGGAGCATTTTGCAGCACTCCAGAGCCTGCT
HKR372080 RBd30D08 pGCAP10 NM_014186.3  
GATTTTGCAGCACTCCAGAGCCTGCTCAAGGCCTCCTCGAAAGATGTTGTCAGACAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl