Prev. | 

RIKEN DNA Bank Human Resource - THYN1

Gene ID NCBI Gene 29087 |  KEGG hsa:29087
Gene Symbol THYN1
Protein Name thymocyte nuclear protein 1
Synonyms HSPC144|MDS012|MY105|THY28|THY28KD
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086501 IRAL016E05 pDNR-LIB BC006978 NM_199297 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055769 ARe39H01 pKA1U5 NM_014174.2  
GACAGCCTGCGGCGCAGCGGAGGCGGACCGCAGCTCGAGTCTGCAGAGTGTTGGGTCTGT
HKR055771 ARe39H03 pKA1U5 NM_014174.2  
GACAGCCTGCGGCGCAGCGGAGGCGGACCGCANTTCGANATCTGCAGAGTGTTGGGTCTG
HKR056980 ARe42H12 pKA1U5 NM_014174.2  
GGCACAGCCTGCGGCGCAGCGGAGGCGGACCGCAGTTCGAGTCTGCAGAGTGTTGGGTCT
HKR234007 ARiS085A07 pGCAP10 NM_014174.2  
GGCACAGCCTGCGGCGCAGCGGAGGCGGACCGCAGTCGAGTCTGCAGAGTGTTGGGTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl