Prev. |  KEGG KO K01112 > 

RIKEN DNA Bank Human Resource - PHPT1

Gene ID NCBI Gene 29085 |  KEGG hsa:29085
Gene Symbol PHPT1
Protein Name phosphohistidine phosphatase 1
Synonyms CGI-202|HEL-S-132P|HSPC141|PHP|PHP14
Ortholog resources KEGG ortholog (KEGG orthology K01112) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011941 IRAK029O05 pCMV-SPORT6 BC024648 NM_014172 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042170 ARe05H02 pKA1U5 NM_014172.4  
GCCTTCGCTCATTCATCCCTGTCCCAGCCTCAAGGGGCTTCGTCTCTCCTGGGGAAGGGG
HKR053706 ARe34E10 pKA1U5 NM_014172.4  
TGGGGGACTCCGGGAGGAGGAACATGGCGGTGNCGTACCTCGCTCTCATTCCTGATGTGG
HKR055682 ARe39D10 pKA1U5 NM_014172.4  
GAGGGGACTCCGGGAGGAGGAACATGGCGGTGGCGGANCTCGCTCTCATTCCTGATGTGG
HKR069753 ARe74G09 pKA1U5 NM_014172.4  
GGGGACTCCGGGAAGGAGGAATATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGA
HKR074435 ARe86B11 pKA1U5 NM_014172.4  
TGGGGACTCCGGGAGGAGGAATATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGA
HKR182955 ARi57G11 pGCAP10 NM_014172.4  
GGGGACTCCGGGAGGAGGAACATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGAC
HKR218252 ARiS045K12 pGCAP10 NM_014172.4  
GAGGGGACTCCNGGANGANGAACNTGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGG
HKR330080 RBb25D08 pGCAP1 NM_014172.4  
GGGAGGGGACTCCGGGAGGAGGAACATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGT
HKR347273 RBb68D01 pGCAP1 NM_014172.4  
GAGGGGACTCCGGGAAGGAAGGAACATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGT
HKR379207 RBd48A07 pGCAP10 NM_014172.4  
GGGGACTCCGGGAGGAGGAACATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGAC
HKR441854 RBdS104K14 pGCAP10 NM_014172.4  
GAGGGGACTCCGGGAGGAGGAACATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGG
HKR452836 RBdS132B12 pGCAP10 NM_014172.4  
GAGGGGACTCCGGGAGGAGGAACATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGG
HKR452899 RBdS132E03 pGCAP10 NM_014172.4  
GGGGGACTCCGGGAGGAGGAACATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl