Prev. | 

RIKEN DNA Bank Human Resource - GTPBP8

Gene ID NCBI Gene 29083 |  KEGG hsa:29083
Gene Symbol GTPBP8
Protein Name GTP binding protein 8 (putative)
Synonyms HSPC135
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083139 IRAL007O03 pOTB7 BC000003 NM_014170 Full/var
HGY091100 IRAL027M12 pOTB7 BC010137 NM_001008236 Full
HGY095713 IRAL039E17 pOTB7 BC037163 NM_014170 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097226 M01C043B02 pDONR221 MGC11-D01 BC000003 NM_001008235  
HGE097274 M01C043D02 pDONR221 MGC11-D01 BC000003 NM_001008235  
HGE097322 M01C043F02 pDONR221 MGC11-D01 BC000003 NM_001008235  
HGE097370 M01C043H02 pDONR221 MGC11-D01 BC000003 NM_001008235  
HGE097418 M01C043J02 pDONR221 MGC11-D01 BC000003 NM_001008235  
HGE097466 M01C043L02 pDONR221 MGC11-D01 BC000003 NM_001008235  
HGE097514 M01C043N02 pDONR221 MGC11-D01 BC000003 NM_001008235  
HGE097562 M01C043P02 pDONR221 MGC11-D01 BC000003 NM_001008235  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR067373 ARe68H05 pKA1U5 NM_014170.2  
GCCCGCTCTTCTGGGAAGGGAGAATGGCGGCGCCCGGGCTGCGGCTGGGAGCGGGAAGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl