Prev. |  KEGG KO K02881 > 

RIKEN DNA Bank Human Resource - MRPL18

Gene ID NCBI Gene 29074 |  KEGG hsa:29074
Gene Symbol MRPL18
Protein Name mitochondrial ribosomal protein L18
Synonyms HSPC071|L18mt|MRP-L18
Ortholog resource in our bank

  MRPL18

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082704 IRAL006M16 pOTB7 BC001623 NM_014161 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097220 M01C043A20 pDONR221 MGC11-B10 BC001623 NM_014161  
HGE097268 M01C043C20 pDONR221 MGC11-B10 BC001623 NM_014161  
HGE097316 M01C043E20 pDONR221 MGC11-B10 BC001623 NM_014161  
HGE097364 M01C043G20 pDONR221 MGC11-B10 BC001623 NM_014161  
HGE097412 M01C043I20 pDONR221 MGC11-B10 BC001623 NM_014161  
HGE097460 M01C043K20 pDONR221 MGC11-B10 BC001623 NM_014161  
HGE097508 M01C043M20 pDONR221 MGC11-B10 BC001623 NM_014161  
HGE097556 M01C043O20 pDONR221 MGC11-B10 BC001623 NM_014161  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041700 ARe04E04 pKA1U5 NM_014161.3  
AGGAGAGTTGGGGTTCTGAGCGAGTCGTGCGTTTTAGGTTTAGTGTCTTTTCCTTGTCCC
HKR058932 ARe47F12 pKA1U5 NM_014161.3  
GGAGAGTTTGGGGATCTACAGCAGCCAAAGGCTTGTCCCTGACTTTATATGGCTGCGCCT
HKR234088 ARiS085D16 pGCAP10 NM_014161.3  
GACTACAAAGTGCCATGACAGAAGGTGGTGTGGTTCTACGGGAACCTCAGAGAATCTATG
HKR327752 RBb19G08 pKA1U5 NM_014161.3  
GATTCTAGTGCCTTCTAGAAAAGGTTGTAAGAAGGGTGGAGCTTGGAGCTGGGGTGTAAC
HKR361355 RBd03G11 pGCAP10 NM_014161.3  
GAGCAGCCAAAGGCTTGTCCCTGACTTTATATGGCTGCGCCTGGCGAGCGACTGAGTCGT
HKR402969 RBdS007H01 pGCAP10 NM_014161.3  
CGGCCGGCCGATGGTCCCTGACTTTATATGGCTGCGCCTGGCGAGCGACTGAGTCGTCCG
HKR402971 RBdS007H03 pGCAP10 NM_014161.3  
GATATGGCTGCGCCTGGCGAGCGACTGAGTCGTCCGTGAGGAAAAAGAGGCGAGGCTTTT
HKR405976 RBdS014P16 pGCAP10 NM_014161.3  
GAGCCAAAGGCTTGTCCCTGACTTTATATGGCTGCTCCTGGCGAGCGACTGAGTCGTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl