Prev. | 

RIKEN DNA Bank Human Resource - C16orf72

Gene ID NCBI Gene 29035 |  KEGG hsa:29035
Gene Symbol C16orf72
Protein Name chromosome 16 open reading frame 72
Synonyms PRO0149
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR371380 RBd28H12 pGCAP10 NM_014117.2  
GGTGGGCGGTGCTTCTCCTGTCAGCATGTGGGCGGGGTAGGGCGGGGACCAGCAGCCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl