Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - C16orf72

Gene ID (NCBI) 29035
Gene Symbol C16orf72
Protein Name chromosome 16 open reading frame 72
Synonyms PRO0149
Databases KEGG hsa:29035 |  NCBI Gene 29035


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR371380 RBd28H12 pGCAP10 NM_014117.2  
GGTGGGCGGTGCTTCTCCTGTCAGCATGTGGGCGGGGTAGGGCGGGGACCAGCAGCCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl