Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATAD2

Gene ID (NCBI) 29028
Gene Symbol ATAD2
Protein Name ATPase family, AAA domain containing 2
Synonyms ANCCA|PRO2000
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005514 IRAK013N02 pCMV-SPORT6 BC010686 NM_014109 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR208009 ARiS020A09 pGCAP10 NM_014109.3  
GGCGGAAGAGCCAGAGCTGCGAGCGCCTGGAGCTGGATCTCTCTCCGGTCGCGCACGCCG
HKR234890 ARiS087D18 pGCAP10 NM_014109.3  
GAGAATTCGGANCGCGGAANAGCCAGAGCTGCGAGCGCCTGGAGCTGGATCTCTCTCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl