Prev. |  KEGG KO K02871 > 

RIKEN DNA Bank Human Resource - MRPL13

Gene ID NCBI Gene 28998 |  KEGG hsa:28998
Gene Symbol MRPL13
Protein Name mitochondrial ribosomal protein L13
Synonyms L13|L13A|L13mt|RPL13|RPML13
Ortholog resource in our bank

  MRPL13

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018920 IRAK047E24 pBluescriptR BC021744 NM_014078 Full
HGY090254 IRAL025K14 pOTB7 BC009190 NM_014078 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235031 ARiS087J15 pGCAP10 NM_014078.4  
GACTAGGAGAAGGACGTACGGTCCTGCTAGTAGAGGAATATGTCGAGTTTCTCTAGGGCG
HKR247274 ARiS118D02 pGCAP10 NM_014078.4  
TTTGGAGAAGGACGTACGGTCCTGCTAGTAGAGGAATATGTCGAGTTTCTCTAGGGCGCC
HKR370546 RBd26G02 pGCAP10 NM_014078.4  
GAGGACGTACGGTCCTGCTAGTAGAGGAATATGTCGAGTTTCTCTAGGGCGCCCCAGCAA
HKR371207 RBd28A07 pGCAP10 NM_014078.4  
HKR408806 RBdS022A06 pGCAP10 NM_014078.4  
GGTGACCCGGCGTGGCTACTAGGAGAAGGACGTACGGTCCTGCTAGTAGAGGAATATGTC
HKR433462 RBdS083K22 pGCAP10 NM_014078.4  
CGGCCGGCCGATGAGTAGAGGAATATGTCGAGTTTCTCTAGGGCGCCCCAGCAATGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl