Prev. | 

RIKEN DNA Bank Human Resource - COMMD5

Gene ID NCBI Gene 28991 |  KEGG hsa:28991
Gene Symbol COMMD5
Protein Name COMM domain containing 5
Synonyms HCARG|HT002
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083222 IRAL008A22 pOTB7 BC003055 NM_014066 Full
HGY085045 IRAL012K05 pOTB7 BC002672 NM_014066 Full
HGY100693 IRAL051M05 pDNR-LIB BC065729 NM_014066 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004684 W01A011L20 pENTR-TOPO flj0034l23 AK023070 NM_014066  
HGE004688 W01A011L24 pENTR-TOPO flj0034l23 AK023070 NM_014066  
HGE004801 W01A012A01 pENTR-TOPO IRAL012K05 BC002672 NM_014066  
HGE004805 W01A012A05 pENTR-TOPO IRAL012K05 BC002672 NM_014066  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170130 ARi25F10 pGCAP10 NM_014066.3  
GGAAGTGGCTCTCAGGGCGCTTCCGGGGACCAGGCCCGCTTTTGGCTGCATCAGCCGGGG
HKR420783 RBdS051P23 pGCAP10 NM_014066.3  
GAGCCGGGGATTGCCGGCGCCAGGTGCTGGGGGCGACTCGGACAGCGGGAGCGTGGGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl