Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NTMT1

Gene ID (NCBI) 28989
Gene Symbol NTMT1
Protein Name N-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms AD-003|C9orf32|HOMT1A|METTL11A|NRMT|NTM1A
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081943 IRAL004O07 pOTB7 BC001396 NM_014064 Full
HGY097477 IRAL043L13 pOTB7 BC033234 NM_014064 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR182578 ARi56H10 pGCAP10 NM_014064.2
TAAGGCAGCGCGCGCCGCGAGCTGTCGCGTCTGGTCGTGGTCTGGCGGAGCTGCGGTTGG
HKR065283 ARe63D11 pKA1U5 NM_014064.2
GGCGTCTGGTCGTGGTCTGGCGGAGCTGCGGTTGGCTTGTGGCGTCTCCGCCGCCGCCGC
HKR208146 ARiS020G02 pGCAP10 NM_014064.2
GGTGGTCTGGCGGAGCTGCGGTTGGCTTGTGGCGTCTCCGCCGCCGCCGCCCTCCCTTCC
HKR391321 RBd78F01 pGCAP10 NM_014064.2
GGCGCGCCGCGAGCTGTCGCGTCTGGTCGTGGTCTGGCGGAGCTGCGGTTGGCTTGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl