Prev. | 

RIKEN DNA Bank Human Resource - TMEM14A

Gene ID NCBI Gene 28978 |  KEGG hsa:28978
Gene Symbol TMEM14A
Protein Name transmembrane protein 14A
Synonyms C6orf73|PTD011
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083363 IRAL008G19 pOTB7 BC019328 NM_014051 Full
HGY092459 IRAL031C11 pDNR-LIB BC015097 NM_014051 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE003894 W01A009M06 pENTR-TOPO IRAL031C11 BC015097 NM_014051  
HGE003908 W01A009M20 pENTR-TOPO IRAL008G19 BC019328 NM_014051  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR077679 ARe94D07 pKA1U5 NM_014051.3  
GGAGTGGGACAGCGCTGGTGCGGAGACTGCTTCCGGACTCCAGGTACCGCGCTTGGCGGC
HKR082569 ARf06H01 pKA1U5 NM_014051.3  
GGACAGCGCTGGTGCGGAGACTGCTTCCGGACTCCAGGTACCGCGCTTGGCGGCAGCTGG
HKR166805 ARi17A05 pGCAP10 NM_014051.3  
GGCTCAGCGCGAGACGGCTGGGCGCCGAGTGGGACAGCGCTGGTGCGGAGACTGCTTCCG
HKR379205 RBd48A05 pGCAP10 NM_014051.3  
GGGGACAGCGCTGGTGCGGAGACTGCTTCCGGACTCCAGGTACCGCGCTTGGCGGCAGCT
HKR392575 RBd81H07 pGCAP10 NM_014051.3  
GGAGACGGCTGGGCGCCGAGTGGGACAGCGCTGGTGCGGAGACTGCTTCCGGACTCCAGG
HKR432690 RBdS081M02 pGCAP10 NM_014051.3  
GGCTCAGCGCGAGACGGCTGGGCGCCGAGTGGGACAGCGCTGGTGCGGAGACTGCTTCCG
HKR444293 RBdS110M05 pGCAP10 NM_014051.3  
GGCGAGACGGCTGGGCGCCGAGTGGGACAGCGCTGGTGCGGAGACTGCTTCCGGACTCCA
HKR461671 RBdS154C23 pGCAP10 NM_014051.3  
GGAGACGGCTGGGCGCCGAGTGGGACAGCGCTGGTGCGGAGACTGCTTCCGGACTCCAGG
HKR461930 RBdS154N18 pGCAP10 NM_014051.3  
GGAGACGGCTGGGCGCCGAGTGGGACAGCGCTGGTGCGGAGACTGCTTCCGGACTCCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl