Prev. |  KEGG KO K16174 > 

RIKEN DNA Bank Human Resource - MRPS18B

Gene ID NCBI Gene 28973 |  KEGG hsa:28973
Gene Symbol MRPS18B
Protein Name mitochondrial ribosomal protein S18B
Synonyms C6orf14|HSPC183|HumanS18a|MRP-S18-2|MRPS18-2|PTD017|S18amt
Ortholog resource in our bank

  MRPS18B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086489 IRAL016D17 pDNR-LIB BC005373 NM_014046 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164927 ARi12F07 pGCAP10 NM_014046.3  
GATTCCTGTCCTGGGCGTACGTCAAGATGGCGGCGTCTGTATTAAACACCGTGCTGAGGC
HKR362573 RBd06H05 pGCAP10 NM_014046.3  
GATTCGTCTCTGCGCNGCAGGTGTTCTGGAGATATTTGCTAACTGGATTCCCCCCCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl