Prev. |  KEGG KO K12946 > 

RIKEN DNA Bank Human Resource - SPCS1

Gene ID NCBI Gene 28972 |  KEGG hsa:28972
Gene Symbol SPCS1
Protein Name signal peptidase complex subunit 1
Synonyms HSPC033|SPC1|SPC12|YJR010C-A
Ortholog resource in our bank

  SPCS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001782 IRAK004H14 pCMV-SPORT6 BC000884 NM_014041 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR063675 ARe59D03 pKA1U5 NM_014041.3  
TTGTGCGGGCTTAGAAGGCCCGGCTACTGACGCGCAGTTGCCAGACCTTACCCCTCACGG
HKR162060 ARi05C12 pGCAP10 NM_014041.3  
GGCCGCCGCCATCGCTCTCCCGGGCTTAGAAGGCCCGGCTACTGACGCGCAGTGCCAGAC
HKR164412 ARi11A12 pGCAP10 NM_014041.3  
GGCCGCCATCGCTCTCCCGGGCTTAGAAGGCCCGGCTACTGACGCGCAGTGCCAGACCTT
HKR168898 ARi22E02 pGCAP10 NM_014041.3  
CGGCCGGCCGATGGCCGCCATCGCTCTCCCGGGCTTAGAAGGCCCGGCTACTGACGCGCA
HKR168978 ARi22H10 pGCAP10 NM_014041.3  
GGGGGCCGCCGCCATCGCTCTCCCGGGCTTAGAAGGCCCGGCTACTGACGCGCAGTGCCA
HKR183303 ARi58E07 pGCAP10 NM_014041.3  
GGGGGCCGCCGCCATCGCTCTCCCGGGCTTAGAAGGCCCGGCTACTGACGCGCAGTGCCA
HKR218036 ARiS045B12 pGCAP10 NM_014041.3  
GCCGCCATCGCTCTCCCGGGCTTAGAAGGCCCGGCTACTGACGCGCAGTGCCAGACCTTA
HKR260229 ARiS150J13 pGCAP10 NM_014041.3  
GGCCGCCATCGCTCTCCCGGGCTTAGAAGGCCCGGCTACTGACGCGCAGTGCCAGACCTT
HKR344950 RBb62G06 pGCAP1 NM_014041.3  
AGTTCTCTTTATACTTCATTTCTAGCCCAGTTGGGTTTTGATTTATATAANTAGTTTAGA
HKR375254 RBd38C06 pGCAP10 NM_014041.3  
GACTGACGCGCAGTGCCAGACCTTAGCCCTCACGGTCCTTAAGTCTCGGTCGCCCTCGCC
HKR384971 RBd62H03 pGCAP10 NM_014041.3  
GGCCGCCATCGCTCTCCCGGGCTTAGAAGGCCCGGCTACTGACGCGCAGTGCCAGACCTT
HKR433562 RBdS083P02 pGCAP10 NM_014041.3  
GGGGCTTAGAAGGCCCGGCTACTGACGCGCAGTGCCAGACCTTACCCCTCACGGTCCTTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl