Prev. | 

RIKEN DNA Bank Human Resource - BZW2

Gene ID NCBI Gene 28969 |  KEGG hsa:28969
Gene Symbol BZW2
Protein Name basic leucine zipper and W2 domains 2
Synonyms HSPC028|MST017|MSTP017
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083378 IRAL008H10 pOTB7 BC003056 NM_014038 Full
HGY088500 IRAL021E04 pDNR-LIB BC008453 NM_014038 Full
HGY088589 IRAL021H21 pDNR-LIB BC009597 NM_014038 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR328029 RBb20B05 pKA1U5 NM_014038.1  
GGTCTATGTCAATGTGTCTGTCCTTCACTCCTCCATTGATCTGCCGCCACTGCTGCTGCT
HKR393702 RBd84E06 pGCAP10 NM_014038.1  
GACTCCTCCATTGTCTGCCGCCACTGCTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl