Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - BZW2

Gene ID (NCBI) 28969
Gene Symbol BZW2
Protein Name basic leucine zipper and W2 domains 2
Synonyms MST017|MSTP017
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083378 IRAL008H10 pOTB7 BC003056 NM_014038 Full
HGY088500 IRAL021E04 pDNR-LIB BC008453 NM_014038 Full
HGY088589 IRAL021H21 pDNR-LIB BC009597 NM_014038 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR328029 RBb20B05 pKA1U5 NM_014038.1
GGTCTATGTCAATGTGTCTGTCCTTCACTCCTCCATTGATCTGCCGCCACTGCTGCTGCT
HKR393702 RBd84E06 pGCAP10 NM_014038.1
GACTCCTCCATTGTCTGCCGCCACTGCTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl