Prev. |  KEGG KO K17941 > 

RIKEN DNA Bank Human Resource - SNX24

Gene ID NCBI Gene 28966 |  KEGG hsa:28966
Gene Symbol SNX24
Protein Name sorting nexin 24
Synonyms PRO1284|SBBI31
Ortholog resource in our bank

  SNX24

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083579 IRAL008P19 pOTB7 BC010886 NM_014035 Full
HGY101664 IRAL054C16 pOTB7 BC069012 NM_014035 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238426 ARiS096B02 pGCAP10 NM_014035.2  
GAGCCGGCTGGCCGGCGCGGCCATGGAGGTCTACATCCCGTCCTTTCGCTATGAAGAGAG
HKR243793 ARiS109I01 pGCAP10 NM_014035.2  
gggccCcgggcAcGcCCAgGGcgCgGGAGCGGCCGGGTCAGCCCGCAgACCTGATTCCgG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl