Prev. |  KEGG KO K18175 > 

RIKEN DNA Bank Human Resource - COA3

Gene ID NCBI Gene 28958 |  KEGG hsa:28958
Gene Symbol COA3
Protein Name cytochrome c oxidase assembly factor 3
Synonyms CCDC56|COX25|HSPC009|MITRAC12
Ortholog resource in our bank

  COA3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085151 IRAL012O15 pOTB7 BC002698 XR_000628

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042455 ARe06C07 pKA1U5 NM_001040431.1  
GAGTGGCAACATGGCGTTCTTCGGGAGCTGGTGACCCTTCTGGATTCTAAGCGTGGAGAG
HKR042554 ARe06G10 pKA1U5 NM_001040431.1  
GAGTGGCAACATGGCCGTCTTCGGGAGCTGGTGACCCTCTGGATTCTAAGCGTGGAGAGG
HKR347651 RBb69C03 pGCAP1 NM_001040431.1  
GGAGGAGTGGCAACATGGCGTCTTCGGGAGCTGGTGACCCTCTGGATTCTAAGCGTGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl