Prev. | 

RIKEN DNA Bank Human Resource - HDHD5

Gene ID NCBI Gene 27440 |  KEGG hsa:27440
Gene Symbol HDHD5
Protein Name haloacid dehalogenase like hydrolase domain containing 5
Synonyms CECR5
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010656 IRAK026K16 pCMV-SPORT6 BC042540 NM_033070 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324052 RBb10C04 pKA1U5 NM_033070.2  
GGTGCACGTGCGCACGGCGACNGCCGGATGGCTGCTTTGGGGCTGTGTGGCTGCGCTCGG
HKR433208 RBdS083A08 pGCAP10 NM_033070.2  
GGCGCACGGCGACGGCCGGATGGCTGCGTGGGGCTGTGTGGCTGCGCTCGGCGCGGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl