Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MAT2B

Gene ID (NCBI) 27430
Gene Symbol MAT2B
Protein Name methionine adenosyltransferase II, beta
Synonyms MAT-II|MATIIbeta|Nbla02999|SDR23E1|TGR
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX055876 IRAK139L12 pCMV-SPORT6 BC066645 NM_013283 Full/var
HGY086579 IRAL016H11 pDNR-LIB BC005218 NM_182796 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR162550 ARi06G06 pGCAP10 NM_182796.1
GGGAGGAGGTGGCGGCCGCTGAGGCTGCGGCGTGAAGACGGCGGGCATGGTGGGGCGGGA
HKR063652 ARe59C04 pKA1U5 NM_182796.1
GGTTCTGGGCCTAGGGGAGGCGGGCCGAGGGCGTCTGAGCTGAGGCCCGCGTCGATCCTG
HKR205342 ARiS013F22 pGCAP10 NM_182796.1
GCCGCGTCGATCCTGGGTTGGAGGAGGTGGCGGCCGCTGAGGCTGCGGCGTGAAGACGGC
HKR209403 ARiS023I11 pGCAP10 NM_182796.1
GGGAGGAGGTGGCGGCCGCTGAGGCTGCGGCGTGAAGACGGCGGGCATGGTGGGGCGGGA
HKR264519 ARiS161E23 pGCAP10 NM_182796.1
GGGAGGAGGTGGCGGCCGCTGAGGCTGCGGCGTGAAGACGGCGGGCATGGTGGGGCGGGA
HKR369256 RBd23C08 pGCAP10 NM_182796.1
GGGAGGAGGTGGCGGCCGCTGAGGCTGCGGCGTGAAGACGGCGGGCATGGTGGGGCGGGA
HKR337607 RBb44A07 pGCAP1 NM_182796.1
AAAACAAAGACCCAGCAAGAGAAGGCAGAGGCTAAGACCCATCCCGTATCTGCTCTCCTG
HKR345731 RBb64F11 pGCAP1 NM_182796.1

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl