Prev. |  KEGG KO K20176 > 

RIKEN DNA Bank Human Resource - SGSM3

Gene ID NCBI Gene 27352 |  KEGG hsa:27352
Gene Symbol SGSM3
Protein Name small G protein signaling modulator 3
Synonyms CIP85|MAP|RABGAP5|RUSC3|RUTBC3|RabGAP-5|rabGAPLP
Ortholog resource in our bank

  SGSM3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15020 pEGFP-C1-human RUTBC3 Expression vector of human RUN And TBC1 Domain Containing 3 (RUTBC3), fused with N-terminal EGFP, CMV promoter.
RDB19704 pEGFP-C1-hRUTBC3-R165A Retroviral expression vector of human RUTBC3 GAP activity-deficient mutant tagged with EGFP at N-terminus.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084168 IRAL010G24 pOTB7 BC008078 NM_015705 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056145 ARe40G01 pKA1U5 NM_015705.4  
TTGGACTGGGTGCGAGTGGGGAAGCTGCTAACCCGACCCGGATTGGCGCTGAGGTGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.22

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl