Prev. | 

RIKEN DNA Bank Human Resource - TMEM97

Gene ID NCBI Gene 27346 |  KEGG hsa:27346
Gene Symbol TMEM97
Protein Name transmembrane protein 97
Synonyms MAC30
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY029839 IRAK074J23 pBluescriptR BC045655 NM_014573 Full
HGY095936 IRAL039N24 pOTB7 BC017362 NM_014573 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE111216 M01C078A16 pDONR221 06-2_02-F08 BC045655 NM_014573  
HGE111264 M01C078C16 pDONR221 06-2_02-F08 BC045655 NM_014573  
HGE111312 M01C078E16 pDONR221 06-2_02-F08 BC045655 NM_014573  
HGE111360 M01C078G16 pDONR221 06-2_02-F08 BC045655 NM_014573  
HGE111408 M01C078I16 pDONR221 06-2_02-F08 BC045655 NM_014573  
HGE111456 M01C078K16 pDONR221 06-2_02-F08 BC045655 NM_014573  
HGE111504 M01C078M16 pDONR221 06-2_02-F08 BC045655 NM_014573  
HGE111552 M01C078O16 pDONR221 06-2_02-F08 BC045655 NM_014573  
HGE090803 M01C027A03 pDONR221 MGC03-A02 BC045655 NM_014573  
HGE090851 M01C027C03 pDONR221 MGC03-A02 BC045655 NM_014573  
HGE090899 M01C027E03 pDONR221 MGC03-A02 BC045655 NM_014573  
HGE090947 M01C027G03 pDONR221 MGC03-A02 BC045655 NM_014573  
HGE090995 M01C027I03 pDONR221 MGC03-A02 BC045655 NM_014573  
HGE091043 M01C027K03 pDONR221 MGC03-A02 BC045655 NM_014573  
HGE091091 M01C027M03 pDONR221 MGC03-A02 BC045655 NM_014573  
HGE091139 M01C027O03 pDONR221 MGC03-A02 BC045655 NM_014573  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326503 RBb16E07 pKA1U5 NM_014573.2  
GGAAGGCGCGCGGATTTGGCCCCTCTTCTCACATCAGCGGGTCCAGGCCCAACCGACAGA
HKR330408 RBb26A08 pGCAP1 NM_014573.2  
GCCCTCTTCTCACATCAGCGGGTCCAGGCCCAACCGACAGACTATGGGGGCTCCGGCAAC
HKR392898 RBd82E02 pGCAP10 NM_014573.2  
GATTTGGCCCCTCTTCTCACATCAGCGGGTCCAGGCCCAACCGACAGACTATGGGGGCTC
HKR442265 RBdS105L01 pGCAP10 NM_014573.2  
GCCTCTTCTCACATCAGCGGGTCCAGGCCCAACCGACAGACTATGGGGGCTCCGGCAACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl