Prev. |  KEGG KO K14545 > 

RIKEN DNA Bank Human Resource - RRP7A

Gene ID NCBI Gene 27341 |  KEGG hsa:27341
Gene Symbol RRP7A
Protein Name ribosomal RNA processing 7 homolog A
Synonyms BK126B4.3|CGI-96|Rrp7
Ortholog resource in our bank

  RRP7A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011644 IRAK029B20 pCMV-SPORT6 BC031838 NM_015703 Partial
HGX033850 IRAK084K10 pCMV-SPORT6 BC042335 NM_015703 Partial/var
HGY096587 IRAL041H19 pDNR-LIB BC035992 NM_015703 Full
HGY097773 IRAL044H05 pOTB7 BC041639 NM_015703 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066930 ARe67F10 pKA1U5 NM_015703.4  
GGGGTGGCAAGATGGTGGCGCGCAGGAGGAAGTGCGCCGCGCGGGACCCGGAGGACCGTA
HKR170084 ARi25D12 pGCAP10 NM_015703.4  
GGCTCCCGGGTGGCAAGATGGTGGCGCGCAGGAGGAAGTGCGCCGCGCGGGACCCGGAGG
HKR187608 ARi69A08 pGCAP10 NM_015703.4  
CGGTGGCAAGATGGTGGCGCGCAGGAGGAAGTGCGCCGCGCGGGACCCGGAGGACCGTAT
HKR209349 ARiS023G05 pGCAP10 NM_015703.4  
GGGCGGCCCCCGCGCTCCCGGGTGGCAAGATGGTGGCGCGCAGGAGGAAGTGCGCCGCGC
HKR471055 RBdS177K15 pGCAP10 NM_015703.4  
GCGGGNGGCCNCACCNTGGCGCGCGTGACNANNCTCGCGGGGCGGNANCNNNANGACGGN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl