Prev. |  KEGG KO K10583 > 

RIKEN DNA Bank Human Resource - UBE2S

Gene ID NCBI Gene 27338 |  KEGG hsa:27338
Gene Symbol UBE2S
Protein Name ubiquitin conjugating enzyme E2 S
Synonyms E2-EPF|E2EPF|EPF5
Ortholog resources KEGG ortholog (KEGG orthology K10583) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY066973 IRAK167H05 pBluescriptR BC066948 NM_014501
HGY081483 IRAL003L19 pOTB7 BC004236 NM_014501 Partial/var
HGY088890 IRAL022D18 pOTB7 BC007554 NM_014501 Partial/var
HGY100192 IRAL050H24 pOTB7 BC065364 NM_014501 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE088407 M01C021A07 pDONR221 IMS03-A04 BC004236 ENST00000264552  
HGE088455 M01C021C07 pDONR221 IMS03-A04 BC004236 ENST00000264552  
HGE088503 M01C021E07 pDONR221 IMS03-A04 BC004236 ENST00000264552  
HGE088551 M01C021G07 pDONR221 IMS03-A04 BC004236 ENST00000264552  
HGE088599 M01C021I07 pDONR221 IMS03-A04 BC004236 ENST00000264552  
HGE088647 M01C021K07 pDONR221 IMS03-A04 BC004236 ENST00000264552  
HGE088695 M01C021M07 pDONR221 IMS03-A04 BC004236 ENST00000264552  
HGE088743 M01C021O07 pDONR221 IMS03-A04 BC004236 ENST00000264552  
HGE100011 M01C050A11 pDONR221 MGC14-E06 BC004236 ENST00000264552  
HGE100059 M01C050C11 pDONR221 MGC14-E06 BC004236 ENST00000264552  
HGE100107 M01C050E11 pDONR221 MGC14-E06 BC004236 ENST00000264552  
HGE100155 M01C050G11 pDONR221 MGC14-E06 BC004236 ENST00000264552  
HGE100203 M01C050I11 pDONR221 MGC14-E06 BC004236 ENST00000264552  
HGE100251 M01C050K11 pDONR221 MGC14-E06 BC004236 ENST00000264552  
HGE100299 M01C050M11 pDONR221 MGC14-E06 BC004236 ENST00000264552  
HGE100347 M01C050O11 pDONR221 MGC14-E06 BC004236 ENST00000264552  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058077 ARe45D05 pKA1U5 NM_014501.2  
GAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGNCTNTANTGATGCGCGGCGGACGTCGGA
HKR176408 ARi41A08 pGCAP10 NM_014501.2  
GAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGTCGGAG
HKR186034 ARi65B10 pGCAP10 NM_014501.2  
GAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGTCGGAG
HKR208180 ARiS020H12 pGCAP10 NM_014501.2  
GGCTCAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGTC
HKR321298 RBb03E02 pKA1U5 NM_014501.2  
GGCGGGCGGTTATAAAGAGGCAGTGGTGCGCGCGCGGCCGGCTCAGTGCTGCCGGGCACC
HKR327379 RBb18H11 pKA1U5 NM_014501.2  
GTCAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGTCGG
HKR346973 RBb67H05 pGCAP1 NM_014501.2  
GGCTCAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGTC
HKR364097 RBd10E01 pGCAP10 NM_014501.2  
GAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGTCGGAG
HKR366012 RBd15A12 pGCAP10 NM_014501.2  
GGGCTCAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGT
HKR367348 RBd18G04 pGCAP10 NM_014501.2  
GGGCTCAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGT
HKR372104 RBd30E08 pGCAP10 NM_014501.2  
GGGCTCAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGT
HKR379612 RBd49A12 pGCAP10 NM_014501.2  
GGGCTCAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGT
HKR386105 RBd65E09 pGCAP10 NM_014501.2  
GTCAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGTCGG
HKR391682 RBd79D10 pGCAP10 NM_014501.2  
GGGCTCAGTGCTGCCGGGCACCGGGGCGGCGGGTTGGTCTACGCTGTGCGCGGCGGACGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl