Prev. | 

RIKEN DNA Bank Human Resource - PGAP2

Gene ID NCBI Gene 27315 |  KEGG hsa:27315
Gene Symbol PGAP2
Protein Name post-GPI attachment to proteins 2
Synonyms CWH43-N|FRAG1|HPMRS3|MRT17|MRT21
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082902 IRAL007E06 pOTB7 BC009930 NM_014489 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE030618 W01A076J02 pENTR-TOPO IRAL007E06 BC009930 NM_014489  
HGE030620 W01A076J04 pENTR-TOPO IRAL007E06 BC009930 NM_014489  
HGE030624 W01A076J08 pENTR-TOPO IRAL007E06 BC009930 NM_014489  
HGE030626 W01A076J10 pENTR-TOPO IRAL007E06 BC009930 NM_014489  
HGE030628 W01A076J12 pENTR-TOPO IRAL007E06 BC009930 NM_014489  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR327321 RBb18F01 pKA1U5 NM_014489.1  
GCTTGGAGCGCCGCGACTCGGGCTGAGGGAGCTCGGGCCAATCAGAGGGACGGCCCCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl