Prev. |  KEGG KO K12620 > 

RIKEN DNA Bank Human Resource - LSM1

Gene ID NCBI Gene 27257 |  KEGG hsa:27257
Gene Symbol LSM1
Protein Name LSM1 homolog, mRNA degradation associated
Synonyms CASM|YJL124C
Ortholog resource in our bank

  LSM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082573 IRAL006H05 pOTB7 BC001767 NM_014462 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE013031 W01A032J15 pENTR-TOPO IRAL006H05 BC001767 NM_014462  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235209 ARiS088A09 pGCAP10 NM_014462.1  
AGGCCGAACCCCGAAAGCTGAGGGACGGAGGTCAGTGACTCTGGGGTCTCGGGAACCCGG
HKR394882 RBd87D10 pGCAP10 NM_014462.1  
GCCTTCTGCTGCCGAACCCCGAAAGCTGAGGGACGGAGAAAAGCACTTGGTTCTGCTTCG
HKR405396 RBdS013I04 pGCAP10 NM_014462.1  
GGCGGCTGAAAGCCGGGGCAGAAGTGCTGGTCTCGGTCGGGATTCCGGGCTTGGTCCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl