Prev. |  KEGG KO K14008 > 

RIKEN DNA Bank Human Resource - ERLEC1

Gene ID NCBI Gene 27248 |  KEGG hsa:27248
Gene Symbol ERLEC1
Protein Name endoplasmic reticulum lectin 1
Synonyms C2orf30|CIM|CL24936|CL25084|HEL117|XTP3-B|XTP3TPB
Ortholog resource in our bank

  ERLEC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001270 IRAK003C22 pCMV-SPORT6 BC013129 NM_015701
HGX011176 IRAK027P16 pCMV-SPORT6 BC022228 NM_015701 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172548 ARi31G04 pGCAP10 NM_015701.3  
GGGAGGCGGCGTTGCCGGGCTCTCCGGAAGGAGACGTGGCGGCGGTTGGGCCGGTGATAC
HKR186007 ARi65A07 pGCAP10 NM_015701.3  
GGGAGGCGGCGTTGCCGGGCTCTCCGGAAGGAGACGTGGCGGCGGTTGGGCCGGTGATAC
HKR331274 RBb28D02 pGCAP1 NM_015701.3  
GCTCCTCCTCCTCCTCCTCTCCTCCTGGAGCAGAGGAGGTTGTGGCGGTGGCTGGAGAAA
HKR416126 RBdS040F06 pGCAP10 NM_015701.3  
GGCGGAGGCGGCGTTGCCGGGCTCTCCGGAAGGAGACGTGGCGGCGGTTGGGCCGGTGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl