Prev. | 

RIKEN DNA Bank Human Resource - SERP1

Gene ID NCBI Gene 27230 |  KEGG hsa:27230
Gene Symbol SERP1
Protein Name stress associated endoplasmic reticulum protein 1
Synonyms RAMP4
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019221 W01A048A21 pENTR-TOPO flj0011i17 AK090933 NM_014445  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043373 ARe08H05 pKA1U5 NM_014445.3  
GATTCCCGTTGTTGCGTTGCGTTTCCTTCCTCTTTCACTCCGCGCTCACGGCGGCGGCCA
HKR208117 ARiS020E21 pGCAP10 NM_014445.3  
GGTTGGCAGCCGAACCCAAAGTAGATCGAGGCGGCGGGCTGCACATTCCCGTTGTTGCGT
HKR340107 RBb50E11 pGCAP1 NM_014445.3  
GAGATCGAGGCGGCGGGCTGCACATTCCCGTTTGTTGCGTTGCGTTTCCTTCCTCTTTCA
HKR405437 RBdS013J21 pGCAP10 NM_014445.3  
GCTCTTTCACTCCGCGCTCACGGCGGCGGCCAAAGCGGCGGCGACGGCGGCGCGAGAACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl