Prev. |  KEGG KO K05490 > 

RIKEN DNA Bank Human Resource - IL17B

Gene ID NCBI Gene 27190 |  KEGG hsa:27190
Gene Symbol IL17B
Protein Name interleukin 17B
Synonyms IL-17B|IL-20|NIRF|ZCYTO7
Ortholog resource in our bank

  IL17B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR416222 RBdS040J06 pGCAP10 NM_014443.2 VA done
GGGGTTGAGGGTGTGGTGGAGACAAGAAACGCATGCCTGATGGTGTCCTGGTTCAACCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl