Prev. | Human A to Z list > V > 

RIKEN DNA Bank Human Resource - VPS4A

Gene ID (NCBI) 27183
Gene Symbol VPS4A
Protein Name vacuolar protein sorting 4 homolog A (S. cerevisiae)
Synonyms SKD1|SKD1A|SKD2|VPS4|VPS4-1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX035781 IRAK089H13 pCMV-SPORT6 BC047932 NM_013245 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057255 ARe43C07 pKA1U5 NM_013245.2  
GGGACTCGGCTCCCGCTGCGAGCGGCCGCCCTGCCCGCGCACCGCGCTCAGCGCCCACCG
HKR218371 ARiS045P11 pGCAP10 NM_013245.2  
GGCCCTCNGACTCGGCTCCCGCTGCGAGCGGCCGCCCTGCCCGCGCACCGCGCTCAGCGC
HKR321634 RBb04B10 pKA1U5 NM_013245.2  
GGCTGCGAGCGGCCGCCCTGCCCGCGCACCGCGCTCAGCGCCCACCGCCGGGCTTCCCGC
HKR369374 RBd23H06 pGCAP10 NM_013245.2  
TGGGCACCGCGCTCAGCGCCCACCGCCGGGCTTCCCGCGCCGGACCCAGTACCTCGGCTC
HKR380124 RBd50F04 pGCAP10 NM_013245.2  
GACCGCCGGGCTTCCCGCGCCGGACCCAGTACCTCGGCTCCCGGGGCCGGACCGAGGCCG
HKR453086 RBdS132L22 pGCAP10 NM_013245.2  
GGCTGCGAGCGGCCGCCCTGCCCGCGCACCGCGCTCAGCGCCCACCGCCGGGCTTCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl