Prev. | 

RIKEN DNA Bank Human Resource - PRELID1

Gene ID NCBI Gene 27166 |  KEGG hsa:27166
Gene Symbol PRELID1
Protein Name PRELI domain containing 1
Synonyms CGI-106|PRELI|PX19|SBBI12
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005359 IRAK013G15 pCMV-SPORT6 BC013748 NM_013237
HGX008584 IRAK021H16 pCMV-SPORT6 BC013733 NM_013237 Full
HGX069984 IRAK174P24 pCMV-SPORT6 BC078182 NM_013237 Full
HGY082923 IRAL007F03 pOTB7 BC000007 NM_013237 Full
HGY088968 IRAL022G24 pOTB7 BC007268 NM_013237 Full
HGY089518 IRAL023N06 pOTB7 BC008307 NM_013237 Full
HGY090615 IRAL026I23 pOTB7 BC008866 NM_013237 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052531 ARe31F11 pKA1U5 NM_013237.2  
GGGACAACTCATGGCGGCGGCGGCGGCGGCGGCAGCTGCTTGGGCGCGGTGCGGTGGTGA
HKR264722 ARiS161N10 pGCAP10 NM_013237.2  
GGGACAACTCATGGCGGCGGCGGCGGCGGCGGCAGCTGCTTGGGCGCGGTGCGGTGGTGA
HKR337235 RBb43B11 pGCAP1 NM_013237.2  
GGGACAACTCATGGCGGCGGCGGCGGCGGCGGCAGCTGCTTGGGCGCGGTGCGGTGGTGA
HKR390904 RBd77E08 pGCAP10 NM_013237.2  
GGCGCGGCCGGACAACTCATGGCGGCGGCGGCGGCGGCGGCAGCTGCTTGGGCGCGGTGC
HKR432745 RBdS081O09 pGCAP10 NM_013237.2  
GGGAAGTGGCGCGCGGCCGGACAACTCATGGCGGCGGCGGCGGCGGCGGCAGCTGCTTGG
HKR441907 RBdS104M19 pGCAP10 NM_013237.2  
CGGCCGGCCGATGGGACAACTCATGGCGGCGGCGGCGGCGGCGGCAGCTGCTTGGGCGCG
HKR444119 RBdS110E23 pGCAP10 NM_013237.2  
GGCGCGGCCGGACAACTCATGGCGGCGGCGGCGGCGGCGGCAGCTGCTTGGGCGCGGTGC
HKR462753 RBdS156O17 pGCAP10 NM_013237.2  
GGCGCGCGGCCGGACAACTCATGGCGGCGGCGGCGGCGGCGGCAGCTGCTTGGGCGCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl