Prev. |  KEGG KO K06097 > 

RIKEN DNA Bank Human Resource - TJP3

Gene ID NCBI Gene 27134 |  KEGG hsa:27134
Gene Symbol TJP3
Protein Name tight junction protein 3
Synonyms ZO-3|ZO3
Ortholog resource in our bank

  TJP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE124421 M01C111A21 pDONR221 06-2_04-A11 AK128237 NM_014428  
HGE124469 M01C111C21 pDONR221 06-2_04-A11 AK128237 NM_014428  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR371255 RBd28C07 pGCAP10 NM_014428.1  
GGAGACCTGGAGGAGGAAGAGGGGCAGGTGCAGCCGGGAGCTGCGGAGCTGGAGGGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl