Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SNX5

Gene ID (NCBI) 27131
Gene Symbol SNX5
Protein Name sorting nexin 5
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE105219 M01C063A19 pDONR221 06_06-A10 AK129505 NM_152227  
HGE105267 M01C063C19 pDONR221 06_06-A10 AK129505 NM_152227  
HGE105315 M01C063E19 pDONR221 06_06-A10 AK129505 NM_152227  
HGE105363 M01C063G19 pDONR221 06_06-A10 AK129505 NM_152227  
HGE105411 M01C063I19 pDONR221 06_06-A10 AK129505 NM_152227  
HGE105459 M01C063K19 pDONR221 06_06-A10 AK129505 NM_152227  
HGE105507 M01C063M19 pDONR221 06_06-A10 AK129505 NM_152227  
HGE105555 M01C063O19 pDONR221 06_06-A10 AK129505 NM_152227  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048874 ARe22D02 pKA1U5 NM_152227.1  
GGGGGCAGCTGGGATGGTGGCGGAGTCCGGAGNCCTCCTGCCGCCGTCGGGCAGGGAGGC
HKR172922 ARi32F02 pGCAP10 NM_152227.1  
AATAAATTCCCCCCACACCGAAACGCGGTCTTTCTCTAGACGCGTCTTGCTGGGAGAGTG
HKR067254 ARe68C06 pKA1U5 NM_152227.1  
GCTTTTCTCTAGACGCGTCTTGCTGGGAGAGTGTCCGTTGCTTCCCGTCCGTGTCGCGGC
HKR279271 ARiS198C23 pGCAP10 NM_152227.1  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl