Prev. |  KEGG KO K19626 > 

RIKEN DNA Bank Human Resource - INVS

Gene ID NCBI Gene 27130 |  KEGG hsa:27130
Gene Symbol INVS
Protein Name inversin
Synonyms INV|NPH2|NPHP2
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  INVS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX032926 IRAK082F06 pCMV-SPORT6 BC041665 NM_183245 Partial/var
HGX047931 IRAK119N19 pCMV-SPORT6 BC056897 NM_183245 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR264450 ARiS161C02 pGCAP10 NM_014425.2  
GAGAAGGATGTGCGGCCGAAAGCCTCGGGCGGCCTTTTGAGGGGCTCGGCTAGCTTCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl