RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - BBC3

Gene ID	NCBI Gene 27113 \| KEGG hsa:27113
Gene Symbol	BBC3
Protein Name	BCL2 binding component 3
Synonyms	JFY-1\|JFY1\|PUMA
Featured content	Hippo signaling (human)
Featured content	Apoptosis - human
Featured content	Huntington disease - human

Ortholog resource in our bank

  BBC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR399606	RBd99A06	pGCAP10	NM_014417.3	Full
HKR399606	GGACGCGGCGCGAGCCACATGCGAGCGGGCGCCTGGCGGCGGCGGCGGCGGCACCAGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl