Prev. |  KEGG KO K10132 > 

RIKEN DNA Bank Human Resource - BBC3

Gene ID NCBI Gene 27113 |  KEGG hsa:27113
Gene Symbol BBC3
Protein Name BCL2 binding component 3
Synonyms JFY-1|JFY1|PUMA
Featured content Hippo signaling (human)
Featured content Apoptosis - human
Featured content Huntington disease - human
Ortholog resource in our bank

  BBC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR399606 RBd99A06 pGCAP10 NM_014417.3 Full done
GGACGCGGCGCGAGCCACATGCGAGCGGGCGCCTGGCGGCGGCGGCGGCGGCACCAGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl