Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5S

Gene ID (NCBI) 27109
Gene Symbol ATP5S
Protein Name ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
Synonyms ATPW|FB|HSU79253
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY091668 IRAL029C20 pOTB7 BC011549 NM_001003805 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE100414 M01C051A14 pDONR221 MGC15-B07 BC011549 NM_001003805
HGE100462 M01C051C14 pDONR221 MGC15-B07 BC011549 NM_001003805
HGE100510 M01C051E14 pDONR221 MGC15-B07 BC011549 NM_001003805
HGE100558 M01C051G14 pDONR221 MGC15-B07 BC011549 NM_001003805
HGE100606 M01C051I14 pDONR221 MGC15-B07 BC011549 NM_001003805
HGE100654 M01C051K14 pDONR221 MGC15-B07 BC011549 NM_001003805
HGE100702 M01C051M14 pDONR221 MGC15-B07 BC011549 NM_001003805
HGE100750 M01C051O14 pDONR221 MGC15-B07 BC011549 NM_001003805

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR338055 RBb45C07 pGCAP1 NM_015684.2
GAGACGCGGGGACGCTGGCTCGCTCCCTCCCTCCCTCCCTCCGACGCTATCAAATGATGC
HKR393679 RBd84D07 pGCAP10 NM_015684.2
GGGGCCGGCCAGGGTGCCGCAGACGCGGGGACGCTGGCTCGCTCCCTCCCTCCCTCCCTC
HKR405601 RBdS014A01 pGCAP10 NM_015684.2
GGGCCAGGGTGCCGCAGACGCGGGGACGCTGGCTCGCTCCCTCCCTCCCTCCCTCCGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl