Prev. | 

RIKEN DNA Bank Human Resource - GHITM

Gene ID NCBI Gene 27069 |  KEGG hsa:27069
Gene Symbol GHITM
Protein Name growth hormone inducible transmembrane protein
Synonyms DERP2|HSPC282|MICS1|My021|PTD010|TMBIM5
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087699 IRAL019E03 pDNR-LIB BC010354 NM_014394 Full/var
HGY092953 IRAL032G09 pDNR-LIB BC022872 NM_014394 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049729 ARe24F09 pKA1U5 NM_014394.2  
GAGGGAAACTGCGAGGCGAAGGTGACCGGGGACCGAGCATTTCAGATCTGCTCGGTAGAC
HKR065298 ARe63E02 pKA1U5 NM_014394.2  
GCCGGAAGGGAAACTGCGAGGCGAAGGTGACCGGGGTACCGAGCATTTCAGATCTGCTCG
HKR070436 ARe76B12 pKA1U5 NM_014394.2  
GGAAACTGCGAGGCGAAGGTGACCGGGGACCGNGCNTTTCAGATCTGCTCGGTAGACCTG
HKR075353 ARe88G09 pKA1U5 NM_014394.2  
GAGGGAAACTGCGAGGCGAAGGTGACCGGGGACCGAGCATTTCAGATCTGCTCGGTAGAC
HKR079232 ARe98B08 pKA1U5 NM_014394.2  
GGTGCGCCGGAGGAACTGTGCTCTTTGAGGCCGACGCTAGGGGCCCGGAAGGGAAACTGC
HKR168502 ARi21E06 pGCAP10 NM_014394.2  
GAAGGGAAACTGCGAGGCGAAGGTGACCGGGGACCGAGCATTTCAGATCTGCTCGGTAGA
HKR178473 ARi46D01 pGCAP10 NM_014394.2  
GGGAAGGGAAACTGCGAGGCGAAGGTGACCGGGGACCGAGCATTTCAGATCTGCTCGGTA
HKR222297 ARiS055M09 pGCAP10 NM_014394.2  
GAGGGAAACTGCGAGGCGAAGGTGACCGGGGACCGAGCATTTCAGATCTGCTCGGTAGAC
HKR277832 ARiS194J16 pGCAP10 NM_014394.2  
GGGAAGGGAAACTGCGAGGCGAAGGTGACCGGGGACCGAGCATTTCAGATCTGCTCGGTA
HKR279462 ARiS198K22 pGCAP10 NM_014394.2  
NGGGGAAACNGCGAGGCGAAGGTGACCGGGGACCGAGCATTTCAGATCTGCTCGGTAGAC
HKR342154 RBb55G10 pGCAP1 NM_014394.2  
GGGGCCGACGCTAGGGGCCCGGAAGGGAAACTGCGAGGCGAAGGTGACCGGGGACCGAGC
HKR376155 RBd40G11 pGCAP10 NM_014394.2  
GAGGGAAACTGCGAGGCGAAGGTGACCGGGGACCGAGCATTTCAGATCTGCTCGGTAGAC
HKR387251 RBd68C03 pGCAP10 NM_014394.2  
GAGGGGCCCGGAAGGGAAACTGCGAGGCGAAGGTGACCGGGGACCGAGCATTTCAGATCT
HKR406126 RBdS015F06 pGCAP10 NM_014394.2  
GCCGGAAGGGAAACTGCGAGGCGAAGGTGACCGGGGACCGAGCATTTCAGATCTGCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl