Prev. |  KEGG KO K01507 > 

RIKEN DNA Bank Human Resource - PPA2

Gene ID NCBI Gene 27068 |  KEGG hsa:27068
Gene Symbol PPA2
Protein Name inorganic pyrophosphatase 2
Synonyms HSPC124|SCFAI|SCFI|SID6-306
Ortholog resource in our bank

  PPA2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008716 IRAK021N04 pCMV-SPORT6 BC012903 NM_176869 Partial/var
HGX027649 IRAK069C01 pCMV-SPORT6 BC035569 NM_176869 Partial
HGX035207 IRAK088A07 pCMV-SPORT6 BC039462 NM_176866 Partial
HGY096828 IRAL042B04 pOTB7 BC022803 NM_176869 Partial/var
HGY099254 IRAL048C06 pDNR-LIB BC057219 NM_006903 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE090004 M01C025A04 pDONR221 MGC02-B02 BC057219 NM_006903  
HGE090052 M01C025C04 pDONR221 MGC02-B02 BC057219 NM_006903  
HGE090100 M01C025E04 pDONR221 MGC02-B02 BC057219 NM_006903  
HGE090148 M01C025G04 pDONR221 MGC02-B02 BC057219 NM_006903  
HGE090196 M01C025I04 pDONR221 MGC02-B02 BC057219 NM_006903  
HGE090244 M01C025K04 pDONR221 MGC02-B02 BC057219 NM_006903  
HGE090292 M01C025M04 pDONR221 MGC02-B02 BC057219 NM_006903  
HGE090340 M01C025O04 pDONR221 MGC02-B02 BC057219 NM_006903  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064970 ARe62H02 pKA1U5 NM_001034191.1  
GGTGCCTGCGGTTGGGGACCAGTGCAGGGACCGGGTCGCGCCGTGCTATGGCCCTGTACC
HKR173233 ARi33B09 pGCAP10 NM_001034191.1  
TGGGGGACCAGTGCAGGGACCGGGTCGCGCCGTGCTATGGCCCTGTACCACACTGAGGAG
HKR203487 ARiS008L23 pGCAP10 NM_001034191.1  
GGGCTGCTGCGCACGGGTGCCCCAGCCGCTGCGTGCCTGCGGTTGGGGACCAGTGCAGGG
HKR222326 ARiS055N14 pGCAP10 NM_001034191.1  
GGTGCCTGCGGTTGGGGACCAGTGCAGGGACCGGGTCGCGCCGTGCTATGGCCCTGTACC
HKR260161 ARiS150G17 pGCAP10 NM_001034191.1  
GNGGACCGTCATTGACGCCNTGAGCGCGCTGCTGCGGCTGCTGCGCACGGGTGCCCCAGC
HKR430200 RBdS075I08 pGCAP10 NM_001034191.1  
CGGCCGGCCGATGGCGGTTGGGGACCAGTGCAGGGACCGGGTCGCGCCGTGCTATGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl