Prev. |  KEGG KO K15979 > 

RIKEN DNA Bank Human Resource - SND1

Gene ID NCBI Gene 27044 |  KEGG hsa:27044
Gene Symbol SND1
Protein Name staphylococcal nuclease and tudor domain containing 1
Synonyms TDRD11|Tudor-SN|p100
Ortholog resource in our bank

  SND1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082139 IRAL005F19 pOTB7 BC017180 NM_014390 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE043562 W01A108P02 pENTR-TOPO IRAL005F19 BC017180 NM_014390  
HGE043568 W01A108P08 pENTR-TOPO IRAL005F19 BC017180 NM_014390  
HGE043570 W01A108P10 pENTR-TOPO IRAL005F19 BC017180 NM_014390  
HGE043572 W01A108P12 pENTR-TOPO IRAL005F19 BC017180 NM_014390  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048897 ARe22E01 pKA1U5 NM_014390.2  
GGAACGTGTGGCGGCGGCGGAGATCGCGTCTCTTTCGCTCCGNTGTCCCGCTGCTGCTCC
HKR053300 ARe33E04 pKA1U5 NM_014390.2  
GGGCACGCTTGCGCGGCGAGTAGAACGTGTGGCGGCTTGCGGAGATCGCGTCTCTTTCGC
HKR186106 ARi65E10 pGCAP10 NM_014390.2  
GCTCTTTCGCTCCGTGTCCCGCTGCTGCTCCTGTGAGCGCCCGGCGAGTCCGTCCCGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl