Prev. |  KEGG KO K01537 > 

RIKEN DNA Bank Human Resource - ATP2C1

Gene ID NCBI Gene 27032 |  KEGG hsa:27032
Gene Symbol ATP2C1
Protein Name ATPase secretory pathway Ca2+ transporting 1
Synonyms ATP2C1A|BCPM|HHD|PMR1|SPCA1|hSPCA1
Ortholog resource in our bank

  ATP2C1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX024979 IRAK062H11 pCMV-SPORT6 BC028139 NM_001001485 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070945 ARe77G01 pKA1U5 NM_014382.2  
TTTCCTCATCCCCTCCCCGACCCGCCCTCNTCATCCCCCCCTTAAAATCCCTTCCCGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl