Prev. |  KEGG KO K22653 > 

RIKEN DNA Bank Human Resource - NPTN

Gene ID NCBI Gene 27020 |  KEGG hsa:27020
Gene Symbol NPTN
Protein Name neuroplastin
Synonyms GP55|GP65|SDFR1|SDR1|np55|np65
Ortholog resource in our bank

  NPTN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB18968 pCX4-hNPTN-c-HA (282) Retroviral expression vector of human NPTN.
RDB18969 pCX4-hNPTN-c-HA (398) Retroviral expression vector of human NPTN.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013465 IRAK033L01 pBluescriptR BC030773 NM_017455 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053626 ARe34B02 pKA1U5 NM_012428.2  
GGTTGGGTCTTCTGCTAGGGAGGATGTCGGGTTCGTCGCTGCCCAGCGCCCTGGCCCTCT
HKR168056 ARi20C08 pGCAP10 NM_012428.2  
GCCCATTCGCTGTTGGGTCTTCTGCTAGGGAGGATGTCGGGTTCGTCGCTGCCCAGCGCC
HKR342882 RBb57D10 pGCAP1 NM_012428.2  
TGGCTNCGGCGGCAGGAGGAANGACGGGGAAGGACGGAGCCGAGCCGCGGCTGCCTCCCT
HKR396956 RBd92G12 pGCAP10 NM_012428.2  
GTCTCTTCTCGCGAGCCTTGCGGCGGTCGCTCCTCAGCCGCCCACGACCCGGAGCGAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.05

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl