DNA Bank Top |  KEGG KO K09522 > 

RIKEN DNA Bank Human Resource - DNAJC2

Gene ID NCBI Gene 27000 |  KEGG hsa:27000
Gene Symbol DNAJC2
Protein Name DnaJ heat shock protein family (Hsp40) member C2
Synonyms MPHOSPH11|MPP11|ZRF1|ZUO1

Link

Ortholog resource in our bank

  DNAJC2


External database

human DNAJC2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB03842 SEREX clone NGO-St-058 (ID 306, 307) #1 SEREX clone NGO-St-058 (ID 306, 307) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001856 IRAK004K16 pCMV-SPORT6 BC000859
HGX037284 IRAK093D12 pCMV-SPORT6 BC046351
HGY099433 IRAL048J17 pDNR-LIB BC056682
HGY100665 IRAL051L01 pDNR-LIB BC062703

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR122833 ARh07B09 pGCAP1 NM_014377.1  
GGAAAGATCCATCCCGGAAGTGCTTACTGGTCGTCTCCATGCGCCGGTTCCTGGGCGTCT
HKR386945 RBd67G01 pGCAP10 NM_014377.1  
TGGGTTGNCGGGGGTGGGAGGGTGTGAGACTGNNCTCCAAACCANNNAANANNNNTCCCG
HKR388971 RBd72H03 pGCAP10 NM_014377.1  
GGAGACTGGCCTCCACACCACGAAAGATCCATCCCGGAAGTGCTTACTCGTCGTCTCCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl